This is a working overview of Enkephalinase, written for readers who want more than a one-paragraph summary but less than a textbook.
This page was last updated on 2025-07-23 and is reviewed periodically as new material appears.
Reversed-phase high-performance liquid chromatography is the standard technique for estimating peptide purity. The result is a peak-area percentage, which describes how much of the detected material elutes as the main peak in one run. Mass spectrometry confirms the molecular mass and can reveal truncated, adducted, or otherwise modified species. Amino acid analysis or tandem mass spectrometry can address sequence fidelity when identity is in doubt. None of these measurements, taken alone, establishes that a sample is fit for any specific purpose.
Lyophilized selank is normally supplied as a dry powder and is considered stable for extended periods when kept cold and dry. Moisture uptake is the main practical threat, because absorbed water promotes both hydrolysis and aggregation in the solid state. Vials are usually warmed to room temperature before opening so that condensation does not form on the powder. Supplier documentation commonly specifies -20 °C for routine storage, with -80 °C used for material intended to be archived for years.
Published clinical evidence is limited. Most controlled trials were conducted in Russia, enrolled modest numbers of participants, and appeared in Russian-language journals, which restricts independent verification. Reported outcomes include lower anxiety scores, improved attention and memory measures, and changes in fatigue ratings. Reviews written in English note methodological limitations such as small samples and inconsistent endpoints. Whether the compound produces clinically meaningful benefit relative to established anxiolytics is therefore an open question rather than an established finding.
Selank is a synthetic heptapeptide with the sequence Thr-Lys-Pro-Arg-Pro-Gly-Pro. It was designed at the Institute of Molecular Genetics of the Russian Academy of Sciences as a structural analogue of tuftsin, a naturally occurring tetrapeptide fragment of the immunoglobulin heavy chain. The added Pro-Gly-Pro tail was intended to slow enzymatic degradation and extend biological activity. In Russia it is registered as an anxiolytic nasal preparation, while regulators elsewhere have not approved it for clinical use.
Proposed mechanisms centre on modulation of the GABAergic system, with reports of altered expression of genes related to GABA-A receptor subunits and changed monoamine turnover. Some studies describe inhibition of enkephalinase, the enzyme that degrades endogenous enkephalins, which may prolong opioid peptide signalling. Effects on brain-derived neurotrophic factor and on cytokine expression have also been reported. These findings come largely from animal models and small human studies, and the precise primary target remains unresolved.
| Property | Value | Notes |
|---|---|---|
| Typical purity specification | 95 percent or higher by RP-HPLC | Area percentage of the main peak |
| Identity confirmation | Electrospray ionization mass spectrometry | Observed mass compared with the theoretical value near 751.9 Da |
| Recommended dry storage | -20 °C, desiccated | -80 °C for multi-year archival material |
| Solution handling | Prepare fresh; avoid long storage | Sterile filtration reduces microbial load |
| Common synonyms | TKPRPGP; TP-7 | Sequence code and laboratory designation used interchangeably |
Naming for this compound is not fully standardised in English sources. The spelling Selanc appears in some transliterations, and catalogue entries may instead list the peptide sequence itself as the identifier. Reference material sometimes groups it with other short synthetic peptides studied for behavioural effects, which can create confusion when citations are compared. Distinguishing the exact sequence from related tuftsin analogues is therefore a practical first step when reviewing any dataset or specification sheet.
Selank is a synthetic heptapeptide with the sequence Thr-Lys-Pro-Arg-Pro-Gly-Pro, frequently abbreviated as TKPRPGP. It was designed as a structural analogue of tuftsin, a naturally occurring tetrapeptide released by enzymatic cleavage of the immunoglobulin heavy chain. The two additional proline residues at the C-terminal end extend the parent chain and change how the molecule behaves in solution. The free peptide has a calculated molecular mass of approximately 751.9 g/mol and is generally supplied as a lyophilised white to off-white powder.
Development work on the compound began in the 1980s and 1990s at the Institute of Molecular Genetics in Moscow, within the same research programme that produced the peptide Semax. Early investigators sought a tuftsin derivative with improved resistance to enzymatic breakdown and with activity in the central nervous system after peripheral administration. Most of the primary literature from this period was published in Russian, a factor that still shapes how easily the findings can be checked by outside groups.
Measuring peptide exposure inside the brain is technically difficult. Selank is degraded rapidly in plasma, and assays must separate intact peptide from fragments, which favors targeted mass spectrometry over immunoassays alone. Reported half-lives are short, on the order of minutes, so effects observed hours later are attributed to downstream signaling rather than to the parent compound. Blood-brain barrier permeability is debated and rarely quantified directly. Gaps include absent dose-response characterization, inconsistent reporting of purity, and almost no pharmacokinetic data from human participants.
Selank is studied chiefly as an animal-model anxiolytic with proposed secondary effects on memory and immune signaling. Reported mechanisms include modulation of the GABA-A receptor complex, inhibition of enkephalin-degrading enzymes, and shifts in monoamine turnover within limbic structures. Some experiments describe increased expression of brain-derived neurotrophic factor in the hippocampus after repeated dosing. No single molecular target has been confirmed, and the peptide does not bind any receptor with the selectivity typical of a conventional small-molecule drug. Mechanism therefore remains a set of hypotheses rather than an established pathway.
Laboratory work relies on standard behavioral paradigms. Rodents are tested in the elevated plus maze, open field, and passive avoidance tasks, with outcomes compared against diazepam or vehicle controls. Intranasal dosing is used most often because it bypasses first-pass metabolism, though intraperitoneal and intravenous routes also appear in published protocols. Biochemical endpoints include tissue BDNF concentrations, cytokine levels, and monoamine metabolites. Human data are limited to small Russian trials reporting reduced anxiety scores; most were not prospectively registered, and few employed independent outcome assessment.
Reported pharmacological effects center on reduced anxiety-like behavior in animal models and on measures of memory and learning. Proposed contributing mechanisms include modulation of GABAergic signaling, shifts in monoamine turnover, and changes in the activity of enzymes that degrade neuropeptides. Effects on the expression of genes linked to neuroplasticity have also been described. No single molecular target is widely accepted, and whether the behavioral findings arise from one pathway or several remains an open question.
Selank is a synthetic heptapeptide with the sequence Thr-Lys-Pro-Arg-Pro-Gly-Pro. It was designed as a stabilized analogue of tuftsin, a naturally occurring tetrapeptide fragment derived from the immunoglobulin heavy chain. The additional Pro-Gly-Pro segment at the carboxyl terminus is intended to slow enzymatic cleavage. The compound is usually described in the literature as a synthetic peptide with anxiolytic and cognitive-related activity, a label that reflects a research context rather than an approved therapeutic category.
Most published work on selank originates from a small number of research groups in the Russian Federation. A large share of that record appears in Russian-language journals, which limits access for readers who rely on English-indexed databases. Independent replication by laboratories outside the original research network is sparse in publicly available sources. This concentration of origin and language is a frequently noted feature when the compound is summarized in broader reviews of synthetic peptides.
Insulin regulated aminopeptidase (IRAP) is a protein that in humans is encoded by the leucyl and cystinyl aminopeptidase (LNPEP) gene. IRAP is a type II transmembrane protein which belongs to the oxytocinase subfamily of M1 aminopeptidases, alongside ERAP1 and ERAP2. It is also known as oxytocinase, leucyl and cystinyl aminopeptidase, placental leucine aminopeptidase (P-LAP), cystinyl aminopeptidase (CAP), and vasopressinase. IRAP is expressed in different cell types, mainly located in specialized regulated endosomes that can be recruited to the cell surface upon cell type-specific receptor activation.
=== Pain and pain management === Most patients report mild to moderate pain during insertion, and a minority report severe pain. Clinicians tend to underestimate this pain. In a study of 200 insertions, patients rated their peak pain at a mean of 65 on a 100-point scale, while providers rated it at 35. Guidelines historically did not recommend routine pain relief, and patients sharing their experiences on social media in the 2020s increased scrutiny of the practice. In 2025 the American College of Obstetricians and Gynecologists (ACOG) acknowledged that many patients feel clinicians have dismissed their pain. Options include NSAIDs, topical lidocaine, a paracervical block, nitrous oxide, inhaled methoxyflurane (the "green whistle"), and intravenous sedation or general anaesthesia where available. Sedation and general anaesthesia usually require a referral or separate appointment. Some clinics also offer virtual reality headsets for distraction. Evidence for individual methods is mixed. A Cochrane review found that lidocaine gel and most NSAIDs did not reduce pain, while some lidocaine formulations, tramadol and naproxen helped in some groups. A 2026 meta-analysis found no significant effect of virtual reality on pain. Paracervical block is underused in the United States. The US CDC and ACOG recommend that clinicians discuss expected pain and pain relief options with every patient before insertion.
=== Electromagnetic cloaking principles for seismic metamaterials === For seismic metamaterials to protect surface structures, the proposal includes a layered structure of metamaterials, separated by elastic plates in a cylindrical configuration. A prior simulation showed that it is possible to create concealment from electromagnetic radiation with concentric, alternating layers of electromagnetic metamaterials. That study is in contrast to concealment by inclusions in a split-ring resonator designed as an anisotropic metamaterial. The configuration can be viewed as alternating layers of homogeneous isotropic dielectric material. Each dielectric material is much thinner than the radiated wavelength. As a whole, such a structure is an anisotropic medium. The layered dielectric materials surround a conducting cylinder. The layered dielectric materials radiate outward, in a concentric fashion, and the cylinder is encased in the first layer. The other layers alternate and surround the previous layer all the way to the first layer. Electromagnetic wave scattering was calculated and simulated for the layered (metamaterial) structure and the split-ring resonator anisotropic metamaterial, to show the effectiveness of the layered metamaterial.
== Biology == The 7kDa proteins are universally found in Sulfolobus, where two copies (Sul7d, Sul7e) are present as separate genes. The proteins are usually named after the species, e.g. Sso7d for the 7d of S. solfataricus and Sac7e for the 7e of S. acidocaldarius. Sul7a and Sul7b are truncated versions of 7d. "Sso7c" does not appear to be a member of this family. S. tokodaii is unusual in that the two copies only differ by one nucleotide and produce the same protein, so its version is simply called Sto7. Across Sulfolobales, Acidianus, Metallosphaera, and "Candidatus Aramenus" also encode a 7kDa DNA-binding protein, named according to the genus name or the species name in an analogous fashion. Each genome may carry anywhere from 1 to 3 versions of the protein.
lattice energy The energy released upon the formation of one mole of a crystalline ionic compound from its constituent ions, which are assumed to exist initially in the gaseous state. Lattice energy can be viewed as a measure of the cohesive forces that bind ionic solids; it is therefore directly related to many other physical properties of the solid, including solubility, hardness, and volatility.
Sources: en.wikipedia.org
27 May – A study published in Light: Science & Applications describes an additive-free, brine-discharge-free solar-thermal desalination method that uses femtosecond laser-etched superwicking black metal to produce fresh water from real ocean water while collecting nearly all remaining salts as solids. Tests using samples from the Pacific, Atlantic, and Indian Oceans show that the self-cleaning surface can prevent salt and mineral build-up, a major limitation of existing solar desalination systems. 31 May – A Phase 3 trial published in the New England Journal of Medicine reports that daraxonrasib, an investigational oral RAS(ON) inhibitor, nearly doubles median overall survival in patients with previously treated metastatic pancreatic cancer, from 6.6 months with standard chemotherapy to 13.2 months.
=== Faulty paternity tests === Labcorp has been criticized over faulty paternity tests, many of which have resulted in lawsuits. The most notable case was the 2005 false accusation of Washington hairdresser Andre Chreky, who spent $200,000 and years in court proving, despite a false-positive test, that he was not the father. In the trial, it was determined that only five people at Labcorp reviewed data and made paternity determinations, including during 10 hour shifts that required making determinations every 4 minutes.
MGM-16 is an opioid drug which is a synthetic derivative of mitragynine, a natural product derived from the Southeast Asian tree kratom. It is the 9-fluoro derivative of another semi-synthetic mitragynine derivative MGM-15, and is a comparatively potent opioid analgesic with approximately 240 times the potency of morphine. While several semi-synthetic derivatives of mitragynine such as 7-hydroxymitragynine and MGM-15 were widely sold in the United States as unscheduled designer drug alternatives to illicit opioids from around 2023–2026, it is unclear whether MGM-16 has appeared on the market to any significant extent. Nevertheless, on 2 July 2026, the DEA published a notice of intent to schedule three 7-hydroxymitragynine-related substances (mitragynine pseudoindoxyl, MGM-15, and MGM-16) under Schedule I of the Controlled Substances Act. As of August 5th, 2026 MGM-16 has been placed in Schedule I through an emergency temporary scheduling order, making unauthorized possession, manufacture, and distribution illegal under federal law.
The way a drug product is designed and manufactured Its physical and chemical properties Other ingredients it contains The physiologic characteristics of the person taking the drug How the drug is stored
Hazard research is published: researchers report gas stoves disperse nitrogen dioxide – associated with respiratory conditions such as asthma – at unsafe levels also outside kitchens for hours (3 May), a study reported large amounts of microplastic in brains with concentrations being much larger in samples from 2024 compared to 2016 (6 May), an experimental study finds GPT-4-based large language model-powered conversational search increases selective exposure compared to conventional Web search (11 May), a study indicates fish oil omega-3 supplements, widely taken due to associations of high omega-3 levels and good health or cognition, might be a substantial risk factor for atrial fibrillation and stroke except for those who took these already having atrial fibrillation (21 May), and researchers report continued transmission of bird flu within dairy cattle and show that their raw milk can infect mice (24 May).
Sources: en.wikipedia.org
In 1956, a factory in the city released methylmercury in the industrial wastewater resulting in thousands of deaths and many other health problems. This incident alerted the world to the phenomenon of bioaccumulation. While all mercury compounds are toxic, organomercury compounds are especially dangerous because they are readily absorbed from the skin and can cross the blood–brain barrier to cause irreversible brain damage. Methylmercury and related compounds are thought to bind to the sulfur of cysteinyl residues in proteins. Nickel causes a contact dermatitis in up to 20% of people as result of prolonged contact with coins or jewelry. Industrial processing with highly toxic nickel carbonyl can cause acute poisoning; inhalation of nickel and nickel compounds in these settings can cause respiratory tract cancer. Chromium, arsenic, cadmium, mercury, and lead have a strong affinity for sulfur; in the human body they usually bind, via thiol groups (–SH), to enzymes responsible for controlling the speed of metabolic reactions. The resulting sulfur-metal bonds inhibit the proper functioning of the enzymes involved; human health deteriorates, sometimes fatally.
=== Reproductive === Androgens such as testosterone, androstenedione and dihydrotestosterone are required for the development of organs in the male reproductive system, including the seminal vesicles, epididymis, vas deferens, penis and prostate. AAS are testosterone derivatives designed to maximize the anabolic effects of testosterone. AAS are consumed by elite athletes competing in sports like weightlifting, bodybuilding, and track and field. Male recreational athletes take AAS to achieve an "enhanced" physical appearance. AAS consumption disrupts the hypothalamic–pituitary–gonadal axis (HPG axis) in males. In the HPG axis, gonadotropin-releasing hormone (GnRH) is secreted from the arcuate nucleus of the hypothalamus and stimulates the anterior pituitary to secrete the two gonadotropins, follicle stimulating hormone (FSH) and luteinizing hormone (LH). In adult males, LH stimulates the Leydig cells in the testes to produce testosterone which is required to form new sperm through spermatogenesis. AAS consumption leads to dose-dependent suppression of gonadotropin release through suppression of GnRH from the hypothalamus (long-loop mechanism) or from direct negative feedback on the anterior pituitary to inhibit gonadotropin release (short-loop mechanism), leading to AAS-induced hypogonadism.
=== National Institute of Standards and Technology === As of 2018 NIST does not provide certificates for the common stable isotope reference materials. As seen at this link showing the light stable isotope references currently available from NIST, this category includes all of the isotopic references critical for isotopic measurement of hydrogen, carbon, oxygen, nitrogen, and sulfur. However, for most of these materials NIST does provide a report of investigation, which gives a reference value that is not certified (following the definitions of May et al. (2000)). For the above examples of USGS34 and USGS35, NIST reports reference values but has not certified the results of Böhlke et al. (2003). Conversely, NIST has not provided a reference value for IAEA-SO-5. As seen at this link, NIST does certify isotopic reference materials for non-traditional "heavy" isotopic systems including rubidium, nickel, strontium, gallium, and thallium, as well as several isotopic systems that would normally be characterized at "light" but non-traditional such as magnesium and chlorine. While the isotopic composition of several of these materials were certified in the mid-1960s, other materials were certified as recently as 2011 (for example, Boric Acid Isotopic Standard 951a).
CTCCAACATCAAGGAAGATGGCATTTCTAG (sequence source: US FDA ETEPLIRSEN BRIEFING DOCUMENT NDA 206488), 30-mer, 20% G, 43% CG, Predicted Tm: 88.9 °C at 10 μM oligo. Oligo complement CTAGAAATGCCATCTTCCTTGATGTTGGAG DMD-001 Exon 51, ENST00000357033.8 in Ensembl.org, RNA target site marked. Given that the target site is within an exon, this is likely blocking binding of an exonic splice enhancer protein and so altering splicing by interfering with splice regulation. CTCCTACTCAGACTGTTACTCTGGTGACACAACCTGTGGTTACTAAGGAAACTGCCATCT CCAAA[CTAGAAATGCCATCTTCCTTGATGTTGGAG]GTACCTGCTCTGGCAGATTTCAACC GGGCTTGGACAGAACTTACCGACTGGCTTTCTCTGCTTGATCAAGTTATAAAATCACAGA GGGTGATGGTGGGTGACCTTGAGGATATCAACGAGATGATCATCAAGCAGAAG
The Unitized Group Ration (UGR) is a United States military ration used by the United States Armed Forces and Department of Defense (DoD). It is intended to sustain groups of American service members with access to a field kitchen, serving as a field ration and a garrison ration. It is the modern successor to several older alphabetized rations— the A-ration, B-ration, and T-ration—combining them under a single unified system. UGRs are designed to meet the Military Daily Recommended Allowance when averaged over a 5 to 10 day period, with each meal providing between 1,300 and 1,450 kcal. The UGR was introduced in 1999, and is currently known to be used by the U.S. Army, U.S. Marine Corps, U.S. Air Force, and National Guard. The U.S. Navy also reportedly uses the UGR for disembarked operations, using the Navy Standard Core Menu (NSCM) aboard naval vessels. The UGR's individual field and combat equivalent is the better-known Meal, Ready-to-Eat (MRE), with the First Strike Ration (FSR), Long Range Patrol (LRP), and Meal, Cold Weather (MCW) serving as specialized field equivalents.
Sources: en.wikipedia.org
Sealed, desiccated storage at -20 °C or colder is the standard recommendation for research-grade material. Vials should reach room temperature before they are opened, which limits condensation. Repeated temperature cycling is discouraged.
A reported purity value reflects the share of the main peak in one chromatographic run and says nothing about identity. Confirming that the expected sequence is present requires a separate measurement such as mass spectrometry. Purity and identity are distinct questions.
A mass spectrum reports the molecular masses present in a sample and shows whether they match the value expected for selank, near 751.9 Da. It also flags common artifacts such as truncation or adduct formation. It does not establish correct stereochemistry or complete sequence order on its own.
It is a seven-amino-acid peptide, Thr-Lys-Pro-Arg-Pro-Gly-Pro, produced by chemical synthesis rather than extracted from biological tissue. Its design is based on tuftsin, a natural immunomodulatory tetrapeptide. The C-terminal Pro-Gly-Pro segment is a common stabilising motif in short regulatory peptides.